Ptpn18^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ptpn18^em1(IMPC)J
• Name: protein tyrosine phosphatase, non-receptor type 18; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6403887
• Gene: Ptpn18 Location: Chr1:34498843-34514814 bp, + strand Genetic Position: Chr1, 13.25 cM
• Alliance: Ptpn18^em1(IMPC)J page
• IMPC: Ptpn18 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TAGGGATCCTGCAATTTAAG and GCTACCGATTTCCCTTCCCG, which resulted in a 1972 bp deletion beginning at Chromosome 1 position 34,471,279 bp and ending after 34,473,250 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000966996, ENSMUSE00001013859, ENSMUSE00000972361, ENSMUSE00000972732, and ENSMUSE00001085919 (exons 9-13) and 1442 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 230 and early truncation 9 amino acids later. There is a 12 bp (GCACCCATTGCA) insertion at the deletion site. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ptpn18 Mutation: 43 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)