Exoc3l^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Exoc3l^em1(IMPC)J
• Name: exocyst complex component 3-like; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6406426
• Gene: Exoc3l Location: Chr8:106016556-106022733 bp, - strand Genetic Position: Chr8, 53.04 cM
• Alliance: Exoc3l^em1(IMPC)J page
• IMPC: Exoc3l gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AATTGCACTGTTGCTTTCAC and GCTGTACCCATAGCCCAGAT, which resulted in a 4024 bp deletion beginning at Chromosome 8 position 105,289,880 bp and ending after 105,293,903 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000411822, ENSMUSE00000371260, ENSMUSE00000382733, ENSMUSE00000363245, ENSMUSE00000333253, ENSMUSE00000333141, ENSMUSE00000344357, ENSMUSE00000389567, ENSMUSE00000365886, and ENSMUSE00000354408 (exons 5-14) and 2197 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 143 and early truncation 42 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Exoc3l Mutation: 38 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)