Ankrd44^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ankrd44^em1(IMPC)J
• Name: ankyrin repeat domain 44; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6406438
• Gene: Ankrd44 Location: Chr1:54684499-54965546 bp, - strand Genetic Position: Chr1, 27.7 cM
• Alliance: Ankrd44^em1(IMPC)J page
• IMPC: Ankrd44 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTGATGGCTGTATCGCGGT and TTCCTGATCTGGGAGTCGGG, which resulted in a 286 bp deletion beginning at Chromosome 1 position 54,763,622 bp and ending after 54,763,907 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001210942 (exon 7) and 143 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 183 and early truncation 1 amino acids later. There is a single base pair insertion (T) at the deletion site. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ankrd44 Mutation: 57 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)