Clec2g^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Clec2g^em1(IMPC)J
• Name: C-type lectin domain family 2, member g; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6406445
• Gene: Clec2g Location: Chr6:128911344-128961670 bp, + strand Genetic Position: Chr6, 63.11 cM, cytoband F3
• Alliance: Clec2g^em1(IMPC)J page
• IMPC: Clec2g gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTCTGTGGTCTGGACAGTTC and TGTGTCGTGGCTATGAGAGA, which resulted in a 1135 bp deletion beginning at Chromosome 6 position 128,980,911 bp and ending after 128,982,045 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000967171 and ENSMUSE00001067493 (exons 5 and 6) and 849 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 127 and early truncation 12 amino acids later. There is a 9 base pair insertion (ACAATGCAC) at the deletion site. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Clec2g Mutation: 24 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)