Cmtm8^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cmtm8^em1(IMPC)J
• Name: CKLF-like MARVEL transmembrane domain containing 8; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6407416
• Gene: Cmtm8 Location: Chr9:114618411-114673220 bp, - strand Genetic Position: Chr9, 65.2 cM
• Alliance: Cmtm8^em1(IMPC)J page
• IMPC: Cmtm8 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACAAATGTAATCTCAAATGT and ATAATATGTACAGGTTGTGT, which resulted in a 6990 bp deletion beginning at Chromosome 9 position 114,789,313 bp and ending after 114,796,302 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000329345, ENSMUSE00000329328 and ENSMUSE00000359329 (exons 2,3 and 4) and 6298 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 50 and early truncation 58 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cmtm8 Mutation: 6 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)