Lsm2^em1(IMPC)Bay
Endonuclease-mediated Allele Detail

Summary

• Symbol: Lsm2^em1(IMPC)Bay
• Name: LSM2 homolog, U6 small nuclear RNA and mRNA degradation associated; endonuclease-mediated mutation 1, Baylor College of Medicine
• MGI ID: MGI:6414498
• Synonyms: Lsm2^-
• Gene: Lsm2 Location: Chr17:35200838-35204867 bp, + strand Genetic Position: Chr17, 18.52 cM
• Alliance: Lsm2^em1(IMPC)Bay page
• IMPC: Lsm2 gene page

Lsm2^em1(IMPC)Bay/Lsm2^em1(IMPC)Bay mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts in vitro hatch from the zona pellucida and form irregular outgrowths.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 Protein and 4 guide sequences TCTTAACGATTCAGGAGTTGGGG, CCCGTTTAACGGATTGTTGTTGG, ATGCTTAAATGCTGTACCACTGG, AAGTTTTGAGAACTACTAGGAGG, which resulted in a Exon Deletion. (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Lsm2 Mutation: 24 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 4 reference(s)