Rad54l2^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rad54l2^em1(IMPC)Tcp
• Name: RAD54 like 2 (S. cerevisiae); endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6414504
• Synonyms: Rad54l2^-
• Gene: Rad54l2 Location: Chr9:106565281-106666393 bp, - strand Genetic Position: Chr9, 57.98 cM, cytoband F1
• Alliance: Rad54l2^em1(IMPC)Tcp page
• IMPC: Rad54l2 gene page

Rad54l2^em1(IMPC)Tcp/Rad54l2^em1(IMPC)Tcp mice exhibit embryonic lethality, with embryos recovered at E3.5 as early blastocysts but not at E7.5. Blastocysts hatch from the zona pellucida and form irregular outgrowths with few adherent trophoblast giant cells.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1555 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CTTGGTTAGCTAATCTACCT targeting the 5' side and GTTAACGTAAACCAGCTATC targeting the 3' side of a critical region. This resulted in a 520-bp deletion, Chr9:106715931-106716450 (GRCm38). (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Rad54l2 Mutation: 179 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 4 reference(s)