Eny2^em1(IMPC)Bay
Endonuclease-mediated Allele Detail

Summary

• Symbol: Eny2^em1(IMPC)Bay
• Name: ENY2 transcription and export complex 2 subunit; endonuclease-mediated mutation 1, Baylor College of Medicine
• MGI ID: MGI:6414562
• Synonyms: Eny2^-
• Gene: Eny2 Location: Chr15:44291488-44301652 bp, + strand Genetic Position: Chr15, 16.91 cM
• Alliance: Eny2^em1(IMPC)Bay page
• IMPC: Eny2 gene page

Eny2^em1(IMPC)Bay/Eny2^em1(IMPC)Bay mice exhibit embryonic lethality, with embryos recovered at E3.5 as early blastocysts but not at E7.5. Blastocysts hatch from the zona pellucida and form irregular outgrowths with no obvious inner cell mass colony or trophoblast giant cells.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 Protein and 4 guide sequences GAACTGTGTTTAATTACCTCAGG, ACAGCTGGAGAATATTACCCAGG, TTAGGTACATAAGTGCTTAATGG, TTGTGTCATTAGAGCAAATTTGG, which resulted in a Exon Deletion. (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Eny2 Mutation: 8 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 4 reference(s)