About   Help   FAQ
Cfap58em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cfap58em1(IMPC)J
Name: cilia and flagella associated protein 58; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6414771
Gene: Cfap58  Location: Chr19:47926151-48023818 bp, + strand  Genetic Position: Chr19, 40.6 cM
Alliance: Cfap58em1(IMPC)J page
IMPC: Cfap58 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGAAAGACCCCCCAAACAAA and TCATGAGCCCATTTTGCCCA, which resulted in a 350 bp deletion beginning at Chromosome 19 position 47,948,074 bp and ending after 47,948,423 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000617882 (exon 4) and 193 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 147 and early truncation 66 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Cfap58 Mutation:  54 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory