Cfap58^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cfap58^em1(IMPC)J
• Name: cilia and flagella associated protein 58; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6414771
• Gene: Cfap58 Location: Chr19:47926151-48023818 bp, + strand Genetic Position: Chr19, 40.6 cM
• Alliance: Cfap58^em1(IMPC)J page
• IMPC: Cfap58 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGAAAGACCCCCCAAACAAA and TCATGAGCCCATTTTGCCCA, which resulted in a 350 bp deletion beginning at Chromosome 19 position 47,948,074 bp and ending after 47,948,423 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000617882 (exon 4) and 193 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 147 and early truncation 66 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cfap58 Mutation: 54 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)