Gm7694^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gm7694^em1(IMPC)J
• Name: predicted gene 7694; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6415700
• Gene: Gm7694 Location: Chr1:170125768-170133901 bp, - strand Genetic Position: Chr1, 76.84 cM
• Alliance: Gm7694^em1(IMPC)J page
• IMPC: Gm7694 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTACAACTGGGATAATGGG and GCAATATACCCCAAACCTTC, which resulted in a 516 bp deletion beginning at Chromosome 1 position 170,302,481 bp and ending after 170,302,996 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000687523 (exon 2) and 188 bp of flanking intronic sequence including the splice acceptor, donor and start site and is predicted to generate a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Gm7694 Mutation: 13 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)