Tram1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tram1^em1(IMPC)J
• Name: translocating chain-associating membrane protein 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6415735
• Gene: Tram1 Location: Chr1:13634922-13660134 bp, - strand Genetic Position: Chr1, 4.18 cM
• Alliance: Tram1^em1(IMPC)J page
• IMPC: Tram1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AATCAGGGTTTCCACAGGGG and TCTCCCAAATGAACGCACCA, which resulted in a 340 bp deletion beginning at Chromosome 1 position 13,580,800 bp and ending after 13,581,139 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000387757 (exon 2) and 276 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 41 and early truncation 25 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tram1 Mutation: 22 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)