About   Help   FAQ
Kcna5em1(IMPC)Mbp
Endonuclease-mediated Allele Detail
Summary
Symbol: Kcna5em1(IMPC)Mbp
Name: potassium voltage-gated channel, shaker-related subfamily, member 5; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
MGI ID: MGI:6423841
Gene: Kcna5  Location: Chr6:126509514-126512375 bp, - strand  Genetic Position: Chr6, 61.35 cM
Alliance: Kcna5em1(IMPC)Mbp page
IMPC: Kcna5 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Deletion
 
Mutation detailsThis allele from IMPC was generated at UC Davies by injecting CAS9 Protein and 3 guide sequences CCTGCGTCATGGAATGCGATACT, CCCAACTCACGCTCCGCGCCTCG, AACTCACGCTCCGCGCCTCGCGG, which resulted in a Whole-gene deletion. (J:265051)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Kcna5 Mutation:  34 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory