Nup93^em1(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nup93^em1(IMPC)Mbp
• Name: nucleoporin 93; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
• MGI ID: MGI:6430664
• Synonyms: Nup93^-
• Gene: Nup93 Location: Chr8:94941203-95043858 bp, + strand Genetic Position: Chr8, 46.4 cM
• Alliance: Nup93^em1(IMPC)Mbp page
• IMPC: Nup93 gene page

Nup93^em1(IMPC)Mbp/Nup93^em1(IMPC)Mbp mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocytsts in vitro hatch from the zona and form irregular outgrowths with no apparent inner cell mass or trophoblast giant cells.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at UC Davies by injecting CAS9 Protein and 2 guide sequences CAGTATGTCCGTGTCTGGTCAGG, GTGCATTCACTCCCTCTTAAAGG, which resulted in a Exon Deletion. (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Nup93 Mutation: 48 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 4 reference(s)