Ms4a4d^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ms4a4d^em1(IMPC)J
• Name: membrane-spanning 4-domains, subfamily A, member 4D; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6432397
• Gene: Ms4a4d Location: Chr19:11514165-11535831 bp, + strand Genetic Position: Chr19, 8.44 cM, cytoband B
• Alliance: Ms4a4d^em1(IMPC)J page
• IMPC: Ms4a4d gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AATGCTACATTCCCATTTAA and ATGGCGGGATGCCATGGAGG, which resulted in a 6557 bp deletion beginning at Chromosome 19 position 11,548,405 bp and ending after 11,554,961 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000991798, ENSMUSE00000985830, ENSMUSE00001086305, ENSMUSE00000144349 (exons 2,3,4,5) and 6097 bp of flanking intronic sequence including the splice acceptor, donor and start site and is predicted to generate a null allele. There is a 3 bp deletion (ATT) 24 bp before the larger deletion. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ms4a4d Mutation: 20 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)