Dhx15^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dhx15^em1(IMPC)Tcp
• Name: DEAH-box helicase 15; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6442536
• Synonyms: Dhx15^-
• Gene: Dhx15 Location: Chr5:52307545-52347856 bp, - strand Genetic Position: Chr5, 27.51 cM, cytoband C1
• Alliance: Dhx15^em1(IMPC)Tcp page
• IMPC: Dhx15 gene page

Dhx15^em1(IMPC)Tcp/Dhx15^em1(IMPC)Tcp mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts in vitro fail to hatch from the zona pellucida.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1564 was generated at The Centre for Phenogenomics by electroporatingCas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TATGCATGTGAGTCGATTTT targeting the 5' side and GTTTCTCTAATTGCTAGCCC targeting the 3' side of a critical region. This resulted in a 934-bp deletion Chr5:52171035-52171968_insGAG (GRCm38). (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Dhx15 Mutation: 41 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 4 reference(s)