Ccdc198^{em1(IMPC)Ccpcz}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ccdc198^{em1(IMPC)Ccpcz}
• Name: coiled-coil domain containing 198; endonuclease-mediated mutation 1, Institute of Molecular Genetics
• MGI ID: MGI:6442544
• Synonyms: Fame KO
• Gene: Ccdc198 Location: Chr14:49463815-49482902 bp, - strand Genetic Position: Chr14, 25.46 cM, cytoband C1
• Alliance: Ccdc198^{em1(IMPC)Ccpcz} page
• IMPC: Ccdc198 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Czech centre for Phenogenomics by injecting CAS9 Protein and 2 guide sequences CCGACTAGTCTGTACTGGAAATG, CCAAGTGCTAGATTCAGGTCCTT, which resulted in an Exon Deletion. A founder harboring a 661 bp deletion overlapping the entire exon 3 of the gene was used for subsequent breeding. (J:265051, J:337480)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

7 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ccdc198 Mutation: 16 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 4 reference(s)