Btnl1^em1Ahay
Endonuclease-mediated Allele Detail

Summary

• Symbol: Btnl1^em1Ahay
• Name: butyrophilin-like 1; endonuclease-mediated mutation 1, Adrian C Hayday
• MGI ID: MGI:6445624
• Synonyms: Btnl1^indel
• Gene: Btnl1 Location: Chr17:34596106-34605002 bp, + strand Genetic Position: Chr17, 17.98 cM
• Alliance: Btnl1^em1Ahay page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Two gRNAs targeting intron 1 (CCAGCTCCAAGATCCCCCTTGGG) and intron 5 (TCCATAGCACCTTATCCGGTTGG) were used with CRISPR/Cas9 technology to create a knockout where exons 2-5 are deleted. (J:236526)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Btnl1 Mutation: 30 strains or lines available

References

• Original: J:236526 Di Marco Barros R, et al., Epithelia Use Butyrophilin-like Molecules to Shape Organ-Specific gammadelta T Cell Compartments. Cell. 2016 Sep 22;167(1):203-218.e17
• All: 1 reference(s)