Skic3^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Skic3^em1(IMPC)Tcp
• Name: SKI3 subunit of superkiller complex; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6449032
• Synonyms: Skic3^-
• Gene: Skic3 Location: Chr13:76246853-76338435 bp, + strand Genetic Position: Chr13, 40.95 cM
• Alliance: Skic3^em1(IMPC)Tcp page
• IMPC: Skic3 gene page

Skic3^em1(IMPC)Tcp/Skic3^em1(IMPC)Tcp mice exhibit embryonic lethality, with embryos recovered at E7.5 but not at E9.5. Embryos are smaller and show severe developmental delay as small egg cyclinders with poorly organized extra embryonic tissues.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1610 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TGGGTTGGAAGCACGTACCC targeting the 5' side and AGTGAAGTCCTTTTGGTGGT targeting the 3' side of a critical region. This resulted in a 1409-bp del Chr13:76117800 to 76119208 (GRCm38). (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Skic3 Mutation: 81 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 4 reference(s)