Tcp11x2^{em1(IMPC)Hmgu}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tcp11x2^{em1(IMPC)Hmgu}
• Name: t-complex 11 family, X-linked 2; endonuclease-mediated mutation 1, Helmholtz Zentrum Muenchen GmbH
• MGI ID: MGI:6449038
• Gene: Tcp11x2 Location: ChrX:134555447-134594539 bp, - strand Genetic Position: ChrX, 57.26 cM, cytoband F1
• Alliance: Tcp11x2^{em1(IMPC)Hmgu} page
• IMPC: Tcp11x2 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Helmholtz-Zentrum Muenchen by injecting CAS9 Protein and 4 guide sequences CCTTCTACTAGTGATTTGAACAC, GCACATATAGCTTGGGTACAGGG, CCAGATCTAGAGACCAGACCCAT, CCAGAACCATAGCATGAGAGTGA, which resulted in a Exon Deletion. (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tcp11x2 Mutation: 4 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)