Ripk1^em1Hbz
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ripk1^em1Hbz
• Name: receptor (TNFRSF)-interacting serine-threonine kinase 1; endonuclease-mediated mutation 1, Haibing Zhang
• MGI ID: MGI:6449644
• Synonyms: Rip1^K45A
• Gene: Ripk1 Location: Chr13:34186346-34221130 bp, + strand Genetic Position: Chr13, 14.01 cM
• Alliance: Ripk1^em1Hbz page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Modified isoform(s))
• Mutation: Nucleotide substitutions
• Mutation details: An sgRNA (targeting GCCCTGTGTATACTTTTTTC) and an ssODN were used with CRISPR/Cas9 technology to change codon 45 from lysine (AAA) to alanine (GCA) (p.K45A). (J:268414)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ripk1 Mutation: 33 strains or lines available

References

• Original: J:268414 Liu Y, et al., RIP1 kinase activity-dependent roles in embryonic development of Fadd-deficient mice. Cell Death Differ. 2017 Aug;24(8):1459-1469
• All: 5 reference(s)