Setbp1^em2Lutzy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Setbp1^em2Lutzy
• Name: SET binding protein 1; endonuclease-mediated mutation 2, Cathy Lutz
• MGI ID: MGI:6452200
• Synonyms: Setbp1^S858R
• Gene: Setbp1 Location: Chr18:78793595-79152606 bp, - strand Genetic Position: Chr18, 52.67 cM, cytoband E3
• Alliance: Setbp1^em2Lutzy page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutations: Insertion, Nucleotide substitutions
• Mutation details: CRISPR/Cas9 genome editing is used to insert a S858R point mutation (AGC to AGG on the sense strand) using guide RNA [sense strand; GAGACTATCCCGAGCGACAG] in combination with stranded oligonucleotide donor DNAs [antisense strand; GGAACAGAAGTCGAAAGAGTACCTCCGCCGGGATTCTGAACTCTTCTCTGCTTGGTCGGAGGTGCTGTTGTTGTCTGTCCCGATGCCACTGTCCCTCGGGATAGTCTCCTCGCTGTGGGACTCACTC]. The S858R point mutation associated with Schinzel-Giedion midface retraction syndrome, and Mental retardation, autosomal dominant 29. (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Setbp1 Mutation: 89 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 2 reference(s)