Dlx4^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dlx4^em1(IMPC)J
• Name: distal-less homeobox 4; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6460373
• Gene: Dlx4 Location: Chr11:95031273-95037089 bp, - strand Genetic Position: Chr11, 59.01 cM
• Alliance: Dlx4^em1(IMPC)J page
• IMPC: Dlx4 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTCCAGAAGGGATAAATAC and ACACAAATCGCCAAGGGCCA, which resulted in a 2312 bp deletion beginning at Chromosome 11 position 95,140,139 bp and ending after 95,142,450 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000293308 and ENSMUSE00000336043 (exons 2 and 3) and 1098 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 95 and early truncation 44 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Dlx4 Mutation: 8 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)