Rorc^em1Litt
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rorc^em1Litt
• Name: RAR-related orphan receptor gamma; endonuclease-mediated mutation 1, Dan R Littman
• MGI ID: MGI:6467245
• Synonyms: Rorc-TS
• Gene: Rorc Location: Chr3:94280101-94305583 bp, + strand Genetic Position: Chr3, 40.56 cM, cytoband F2
• Alliance: Rorc^em1Litt page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Insertion
• Mutation details: CRISPR/cas9 genome editing is used to introduce twin-strep (TS) tag sequence into the last exon of the variant coding region (immediately before the stop codon.TS tag encodes two tandem streptavidin-binding peptides (upper case) that are preceded and separated by linker (lower case) sequences: [Last Rorc exon: CTGCCACCCAAAGGAAAACTCCGGAGCCTGTGCAGCCAACATGTGGAAAAGCTGCAGATCTTCCAGCACCTCCACCCCATCGTGGTCCAAGCCGCCTTCCCTCCACTCTATAAGGAACTCTTCAGCACTGATGTTGAATCCCCTGAGGGGCTGTCAAAG] ggaggcggatcgggaggcggatcgggcggatcggca TGGTCGCATCCGCAGTTTGAAAAA ggaggcggatcgggaggcggatcgggcgga TCCGCT TGGTCGCATCCGCAGTTTGAAAAG [TGA stop]. (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rorc Mutation: 42 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)