Hsf2bp^em1Roka
Endonuclease-mediated Allele Detail

Summary

• Symbol: Hsf2bp^em1Roka
• Name: heat shock transcription factor 2 binding protein; endonuclease-mediated mutation 1, Ronald Kanaar
• MGI ID: MGI:6467326
• Synonyms: Hsf2bp^-
• Gene: Hsf2bp Location: Chr17:32163743-32253869 bp, - strand Genetic Position: Chr17, 17.25 cM
• Alliance: Hsf2bp^em1Roka page

Mutation origin

• Strain of Origin: C57BL/6JOlaHsd

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Exons 3-6 were deleted using crRNA:tracRNA complexes (targeting ACTGCAGTAGTAAACGGAGG in intron 2 and ACTGCTGGATCAACTGTTTA in intron 6) with CRISPR/Cas9 type II technology. (J:294372)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Hsf2bp Mutation: 24 strains or lines available

References

• Original: J:294372 Brandsma I, et al., HSF2BP Interacts with a Conserved Domain of BRCA2 and Is Required for Mouse Spermatogenesis. Cell Rep. 2019 Jun 25;27(13):3790-3798.e7
• All: 1 reference(s)