Ticrr^em1(IMPC)Bay
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ticrr^em1(IMPC)Bay
• Name: TOPBP1-interacting checkpoint and replication regulator; endonuclease-mediated mutation 1, Baylor College of Medicine
• MGI ID: MGI:6467486
• Synonyms: Ticrr^-
• Gene: Ticrr Location: Chr7:79309944-79347896 bp, + strand Genetic Position: Chr7, 45.09 cM, cytoband D2
• Alliance: Ticrr^em1(IMPC)Bay page
• IMPC: Ticrr gene page

Ticrr^em1(IMPC)Bay/Ticrr^em1(IMPC)Bay mice exhibit embryonic lethality, with embryos recovered at E3.5 as morulae but not at E7.5. Embryos fail to hatch from the zona pellucida and die after 3 days in culture, never forming outgrowths.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 Protein and 2 guide sequences ATAGAAGCTATCGGCCGTTTAGG, CCAGATGTGAGCCGGCTAAATCC, which resulted in a Exon Deletion. (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ticrr Mutation: 82 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 4 reference(s)