Rr272^em1Mad
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr272^em1Mad
• Name: regulatory region 272; endonuclease-mediated mutation 1, Michael A Dyer
• MGI ID: MGI:6469562
• Synonyms: Vsx2 CRC-SE^delta, Vsx2^em1Mad, Vsx2-SE^delta
• Gene: Rr272 Location: unknown Genetic Position: Chr12, Syntenic
• Alliance: Rr272^em1Mad page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Rr272^em1Mad involves 6 genes/genome features (Rr276, Rr275, Rr274 ...) View all
• Mutation details: This Vsx2 bipolar neuron-specific core regulatory circuit super enhancer (CRC-SE) was targeted with sgRNAs (targeting GCAGGCCATGTGCTCGTCGA and CAGGGTGCAGGCTGACAACG) using CRISPR/Cas9 technology, resulting in slightly different deletions in three independent lines: chr12:84579812-84611543 (Vsx2-3-3), 84579815-84611547 (Vsx2-59-12) and 84579815-84611546 (Vsx2-23-3); all coordinates from build GRCm39. The deletions involve super-enhancer component enhancers Rr274, Rr275 and Rr276 (which contains Rr261800 and Rr268660), but not Rr273, and an alternative exon 1 of Lin52. (J:282593)

Expression

In Mice Carrying this Mutation:	2 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation:	1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr272 Mutation: 0 strains or lines available

References

• Original: J:282593 Norrie JL, et al., Nucleome Dynamics during Retinal Development. Neuron. 2019 Nov 6;104(3):512-528.e11
• All: 4 reference(s)