Del(XJpx-Ftx)1Ehea
Endonuclease-mediated Allele Detail

Summary

• Symbol: Del(XJpx-Ftx)1Ehea
• Name: deletion, Chr X, Edith Heard 1
• MGI ID: MGI:6473332
• Synonyms: deltaJpx deltaFtx
• Gene: Del(XJpx-Ftx)1Ehea Location: unknown Genetic Position: ChrX, Syntenic

Mutation origin

• Strain of Origin: (C57BL/6 x DBA/2)F1

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Intergenic deletion, Intragenic deletion
• Del(XJpx-Ftx)1Ehea involves 2 genes/genome features (Jpx, Ftx) View all
• Mutation details: A section of chromosome X encompassing the Jpx and Ftx lncRNA loci was deleted using sgRNAs (GGTCACAATTATGCAACCTG, ATACTCCGGATTACATACTC, TGCCCAAGCAAAAAGCGTGA, AAAGTATTGACACCTTACCC) with CRISPR/Cas9 technology. (J:293830)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Del(XJpx-Ftx)1Ehea Mutation: 0 strains or lines available

References

• Original: J:293830 Collombet S, et al., Parental-to-embryo switch of chromosome organization in early embryogenesis. Nature. 2020 Apr;580(7801):142-146
• All: 1 reference(s)