Lrrc34^em1Doson
Endonuclease-mediated Allele Detail

Summary

• Symbol: Lrrc34^em1Doson
• Name: leucine rich repeat containing 34; endonuclease-mediated mutation 1, DongSong Nie
• MGI ID: MGI:6476971
• Synonyms: Spata34^-
• Gene: Lrrc34 Location: Chr3:30678416-30701967 bp, - strand Genetic Position: Chr3, 14.27 cM, cytoband A3
• Alliance: Lrrc34^em1Doson page

Mutation origin

• Strain of Origin: (C57BL/6 x DBA/2J)F1

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Exons 3 and 4 were targeted with sgRNAs (GATCACTAATACGACTCACTATAGGCTCCGGACAAAGAATAACGTTTTAGCTAGAAAT and GATCACTAATACGACTCACTATAGGCATCGGCGATGTCGGTGCGTTTTAGAGCTAGAAAT) using CRISPR/Cas9 technology, resulting in a 274 bp deletion (including a 122 bp deletion of the entire exon 3 and a 35 bp deletion of the 5' end of exon 4). RT-PCR experiments confirm lack of expression from this allele. (J:293535)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Lrrc34 Mutation: 47 strains or lines available

References

• Original: J:293535 Nie D, et al., The testis-specific expressed gene Spata34 is not required for fertility in mice. Mol Biol Rep. 2020 Jan;47(1):285-292
• All: 1 reference(s)