Lrrc55os^em1Caox
Endonuclease-mediated Allele Detail

Summary

• Symbol: Lrrc55os^em1Caox
• Name: leucine rich repeat containing 55, opposite strand; endonuclease-mediated mutation 1, Xuetao Cao
• MGI ID: MGI:6477292
• Synonyms: lncLrrc55-AS
• Gene: Lrrc55os Location: Chr2:85002869-85004284 bp, + strand Genetic Position: Chr2, 49.48 cM
• Alliance: Lrrc55os^em1Caox page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout, Reporter)
• Mutations: Insertion, Intragenic deletion
• Mutation details: Exon 1 was targeted with sgRNAs (TAGGCTCTCTGCAATGGCTGAC, AAACGTCAGCCATTGCAGAGAG, TAGGGGTAAGCAGGTTGCTGA and AAACCTCAGCAACCTGCTTACC) and a donor plasmid containing a GFP gene and poly(A) signal sequence using CRISPR/Cas9 technology. This resulted an a knockout reporter allele where exon 1 is replaced with the GFP gene. (J:293325)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Lrrc55os Mutation: 0 strains or lines available

References

• Original: J:293325 Zhou Y, et al., Interferon-inducible cytoplasmic lncLrrc55-AS promotes antiviral innate responses by strengthening IRF3 phosphorylation. Cell Res. 2019 Aug;29(8):641-654
• All: 1 reference(s)