Del(XMir465d-Mir465)3Utr
Endonuclease-mediated Allele Detail

Summary

• Symbol: Del(XMir465d-Mir465)3Utr
• Name: deletion, Chr X, Ken-ichi Yagami 3
• MGI ID: MGI:6477602
• Synonyms: Del(XMir465d-Mir465)1Semi
• Gene: Del(XMir465d-Mir465)3Utr Location: unknown Genetic Position: ChrX, Syntenic

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Intergenic deletion, Intragenic deletion
• Mutation details: The entire cluster (Mir465d, Mir465c-1, Mir465b-1, Mir465c-2,Mir465b-2, and Mir465) was targeted for deletion with sgRNAs (TATGAGGCTATGCTACTGCA and TGATTTATAAGTCCTCGGAA) using CRISPR/Cas9 technology. (J:292550)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Del(XMir465d-Mir465)3Utr Mutation: 0 strains or lines available

References

• Original: J:292550 Morimoto K, et al., Reverse genetics reveals single gene of every candidate on Hybrid sterility, X Chromosome QTL 2 (Hstx2) are dispensable for spermatogenesis. Sci Rep. 2020 Jun 3;10(1):9060
• All: 1 reference(s)