Gm6812^em1Utr
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gm6812^em1Utr
• Name: predicted gene 6812; endonuclease-mediated mutation 1, University of Tsukuba Laboratory Animal Resource Center
• MGI ID: MGI:6477606
• Synonyms: Gm6812^em1Semi
• Gene: Gm6812 Location: ChrX:67935979-67936656 bp, - strand Genetic Position: ChrX, 34.9 cM
• Alliance: Gm6812^em1Utr page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: The entire locus was targeted for deletion with sgRNAs (TAGCCCACACTCCTCCTACA and GTCTAAGGTGAACCAGATGT) using CRISPR/Cas9 technology. (J:292550)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Gm6812 Mutation: 2 strains or lines available

References

• Original: J:292550 Morimoto K, et al., Reverse genetics reveals single gene of every candidate on Hybrid sterility, X Chromosome QTL 2 (Hstx2) are dispensable for spermatogenesis. Sci Rep. 2020 Jun 3;10(1):9060
• All: 1 reference(s)