About   Help   FAQ
Gcn1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Gcn1em1(IMPC)J
Name: GCN1 activator of EIF2AK4; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6477990
Gene: Gcn1  Location: Chr5:115703313-115760713 bp, + strand  Genetic Position: Chr5, 56.1 cM
Alliance: Gcn1em1(IMPC)J page
IMPC: Gcn1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTACAGAGCAGGGCTCAGCA and GCTGGTGTAGAGCCACTGGT, which resulted in a 1611 bp deletion beginning at Chromosome 5 position 115,574,333 bp and ending after 115,575,943 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001249622, ENSMUSE00001219534(exons 3 and 4) and 1415 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 40 and early truncation 11 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Gcn1 Mutation:  138 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/09/2024
MGI 6.24
The Jackson Laboratory