Amigo2^em#Dke
Endonuclease-mediated Allele Detail

Summary

• Symbol: Amigo2^em#Dke
• Name: adhesion molecule with Ig like domain 2; endonuclease-mediated mutation, Daniel Kerschensteiner
• MGI ID: MGI:6478808
• Synonyms: Amigo KO
• Gene: Amigo2 Location: Chr15:97142006-97145168 bp, - strand Genetic Position: Chr15, 52.91 cM
• Alliance: Amigo2^em#Dke page

Mutation origin

• Strain of Origin: C57BL/6J x DBA/2

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Deletions were created by targeting TALENs to TCAGGAATGTGCCCCACTGC and TTGGTGCAGCTGACAATGTC. Four mouse lines, with 2-bp, 8-bp, 22-bp, and 43-bp deletions, respectively, were selected for further breeding and experimental data from these four lines was pooled. The pound # sign in the allele symbol is used for this pooled allele. (J:292404)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Amigo2 Mutation: 25 strains or lines available

References

• Original: J:292404 Soto F, et al., AMIGO2 Scales Dendrite Arbors in the Retina. Cell Rep. 2019 Nov 5;29(6):1568-1578.e4
• All: 2 reference(s)