Brme1em1Keish
Endonuclease-mediated Allele Detail
|
Symbol: |
Brme1em1Keish |
Name: |
break repair meiotic recombinase recruitment factor 1; endonuclease-mediated mutation 1, Kei-ichiro Ishiguro |
MGI ID: |
MGI:6478915 |
Synonyms: |
4930432K21Rik Ex3-9delta, Brme1 KO |
Gene: |
Brme1 Location: Chr8:84874654-84899219 bp, + strand Genetic Position: Chr8, 40.35 cM, cytoband C3
|
Alliance: |
Brme1em1Keish page
|
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: Exons 3-9 were targeted for deletion with two synthetic crRNAs (targeting GCAGGAAGTTCATAGCCACA(ggg) and TGGGTAACAGATCTACACAC(agg)) and an ssODN (GGCTACAACTACAGGGAGGTTTTGTGCTCTCTAACCTGTGaattcGGCTATGAACTTCCTGCCGC CATCAGCTTCCAAAATACAG) using CRISPR/Cas9 technology.
(J:291970)
|
|
|
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Brme1 Mutation: |
24 strains or lines available
|
|
Original: |
J:291970 Takemoto K, et al., Meiosis-Specific C19orf57/4930432K21Rik/BRME1 Modulates Localization of RAD51 and DMC1 to DSBs in Mouse Meiotic Recombination. Cell Rep. 2020 May 26;31(8):107686 |
All: |
1 reference(s) |
|