Dnttip1^em1Shmc
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dnttip1^em1Shmc
• Name: deoxynucleotidyltransferase, terminal, interacting protein 1; endonuclease-mediated mutation 1, Shaun M Cowley
• MGI ID: MGI:6479050
• Synonyms: DNTTIP1-del1^-
• Gene: Dnttip1 Location: Chr2:164587935-164610140 bp, + strand Genetic Position: Chr2, 85.27 cM, cytoband H3
• Alliance: Dnttip1^em1Shmc page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Exon 2 sequence (AACATCGGCAGGTGCAGCGAAGG) was targeted with a crRNA using CRISPR/Cas9 technology, resulting in an 11 bp deletion. (J:291786)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Dnttip1 Mutation: 24 strains or lines available

References

• Original: J:291786 Turnbull RE, et al., The MiDAC histone deacetylase complex is essential for embryonic development and has a unique multivalent structure. Nat Commun. 2020 Jun 26;11(1):3252
• All: 1 reference(s)