Stra8^em4Keish
Endonuclease-mediated Allele Detail

Summary

• Symbol: Stra8^em4Keish
• Name: stimulated by retinoic acid gene 8; endonuclease-mediated mutation 4, Kei-ichiro Ishiguro
• MGI ID: MGI:6488119
• Synonyms: Stra8 KO
• Gene: Stra8 Location: Chr6:34897098-34916279 bp, + strand Genetic Position: Chr6, 15.2 cM
• Alliance: Stra8^em4Keish page

Mutation origin

• Strain of Origin: (C57BL/6J x 129S6/SvEvTac)F1

Mutation description

• Allele Type: Endonuclease-mediated (Epitope tag, Null/knockout, Reporter)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele is derived from the Stra8^em1Keish allele, which was generated as follows: sequence for three FLAG tags and an HA tag was inserted in-frame into the 3' UTR in exon 9, followed by p2A self-cleaving sequence and the GFP fluorescent marker gene, using CRISPR/Cas9 technology with gRNAs targeting GCCTCAGGTCACATTATCGG(tgg) and TGCAATCAGTTCCGACTCTC(tgg). A neomycin resistance gene cassette was inserted downstream of the gene. Subsequent CRISPR/Cas9 targeting with a crRNA (targeting ACAGATCGTCAAAGGTCTCC(agg) in exon 9) and tracrRNA resulted in a 1 bp (A) deletion. (J:290712)

Expression

In Mice Carrying this Mutation:

21 assay results

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Stra8 Mutation: 36 strains or lines available

References

• Original: J:290712 Ishiguro KI, et al., MEIOSIN Directs the Switch from Mitosis to Meiosis in Mammalian Germ Cells. Dev Cell. 2020 Feb 24;52(4):429-445.e10
• All: 1 reference(s)