Meiosin^em1Keish
Endonuclease-mediated Allele Detail

Summary

• Symbol: Meiosin^em1Keish
• Name: meiosis initiator; endonuclease-mediated mutation 1, Kei-ichiro Ishiguro
• MGI ID: MGI:6488129
• Synonyms: Meiosin KO
• Gene: Meiosin Location: Chr7:18832971-18852293 bp, - strand Genetic Position: Chr7, 9.46 cM
• Alliance: Meiosin^em1Keish page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: crRNAs targeting CAGTTGTGACTAGAGACTAG(tgg) in intron 5 and ATGCTTATGGAATTGATACG(tgg) in the region downstream of exon 14 and ssODN gggTGTCAAAGTATAGAAGCAAAATGCTTATGGAATTGATTTTATTTATTTAGGCAGGCCATAGTCCCACTTCACAGGTATGTGCACT were used with CRISPR/Cas9 technology to delete exons 6-14. (J:290712)

Expression

In Mice Carrying this Mutation:	36 assay results
In Structures Affected by this Mutation:	3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Meiosin Mutation: 9 strains or lines available

References

• Original: J:290712 Ishiguro KI, et al., MEIOSIN Directs the Switch from Mitosis to Meiosis in Mammalian Germ Cells. Dev Cell. 2020 Feb 24;52(4):429-445.e10
• All: 2 reference(s)