N4bp1^em1Vmd
Endonuclease-mediated Allele Detail

Summary

• Symbol: N4bp1^em1Vmd
• Name: NEDD4 binding protein 1; endonuclease-mediated mutation 1, Vishva Dixit
• MGI ID: MGI:6490607
• Synonyms: N4bp1^D488A
• Gene: N4bp1 Location: Chr8:87567764-87612489 bp, - strand Genetic Position: Chr8, 42.1 cM
• Alliance: N4bp1^em1Vmd page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: CRISPR-targeting with an sgRNA (equivalent to ACTGTCGACCTGGAAACTGA) and an ssODN template changed aspartic acid 488 (GAT) in exon 2 to alanine (GCA) (p.D488A). The encoded peptide is predicted to be resistant to cleavage. (J:297419)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any N4bp1 Mutation: 46 strains or lines available

References

• Original: J:297419 Gitlin AD, et al., Integration of innate immune signalling by caspase-8 cleavage of N4BP1. Nature. 2020 Nov;587(7833):275-280
• All: 1 reference(s)