Pole3^em4Tbo
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pole3^em4Tbo
• Name: polymerase (DNA directed), epsilon 3 (p17 subunit); endonuclease-mediated mutation 4, Thomas Boehm
• MGI ID: MGI:6490636
• Synonyms: Pole3^m4
• Gene: Pole3 Location: Chr4:62440889-62443305 bp, - strand Genetic Position: Chr4, 33.17 cM, cytoband C1
• Alliance: Pole3^em4Tbo page

Mutation origin

• Strain of Origin: FVB

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Insertion
• Mutation details: A 2 bp insertion (GC or CG) in the 3' end of the coding region was created using sgRNAs (targeting CGGGAGCAGAAAGGCAAG) and an ssODN template (CGGTTTGTCTAATTAAACCATAATATCCTGCTTCCTTACAGCGTACAGGCAGGAACAGAAGGGCAAGAAGGAGGCTTCGGAGCAAAAGAAGAAGGACAAAGACAAAAAGGA) with CRISPR/Cas9 technology. The resulting frameshift creates a large net positive charge on the normally negatively charged tail of the encoded peptide. (J:298827)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Pole3 Mutation: 14 strains or lines available

References

• Original: J:298827 Siamishi I, et al., Lymphocyte-Specific Function of the DNA Polymerase Epsilon Subunit Pole3 Revealed by Neomorphic Alleles. Cell Rep. 2020 Jun 16;31(11):107756
• All: 1 reference(s)