Ythdf2^em2Jhha
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ythdf2^em2Jhha
• Name: YTH N6-methyladenosine RNA binding protein 2; endonuclease-mediated mutation 2, Jacob Hanna
• MGI ID: MGI:6491617
• Synonyms: Ythdf2^-
• Gene: Ythdf2 Location: Chr4:131912227-131939567 bp, - strand Genetic Position: Chr4, 64.92 cM
• Alliance: Ythdf2^em2Jhha page

Mutation origin

• Strain of Origin: (C57BL/6 x BALB/c)F1

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Introns 3 and 4 were targeted with sgRNAs (targeting GTAAATTTTAGGACTACGGT and GTAAATTTTAGGACTACGGT) using CRISPR/Cas9 technology, resulting in the deletion of exon 4. (J:299108)

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ythdf2 Mutation: 32 strains or lines available

References

• Original: J:299108 Lasman L, et al., Context-dependent functional compensation between Ythdf m(6)A reader proteins. Genes Dev. 2020 Oct 1;34(19-20):1373-1391
• All: 1 reference(s)