Cacng2^em1Tern
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cacng2^em1Tern
• Name: calcium channel, voltage-dependent, gamma subunit 2; endonuclease-mediated mutation 1, Terunaga Nakagawa
• MGI ID: MGI:6505622
• Synonyms: CACNG2^-
• Gene: Cacng2 Location: Chr15:77875948-78004228 bp, - strand Genetic Position: Chr15, 36.92 cM
• Alliance: Cacng2^em1Tern page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Single point mutation
• Mutation details: Exon 1 was targeted with an sgRNA (targeting TGAAACCAGCAAGAAGAACG) and an ssODN template, containing a A-to-T mutation (T-to-A on forward strand) in lysine codon 53, using CRISPR/Cas9 technology. The resulting mutation causes premature translation termination (p.K53*). (J:301313)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Cacng2 Mutation: 26 strains or lines available

References

• Original: J:301313 Kamalova A, et al., AMPA Receptor Auxiliary Subunit GSG1L Suppresses Short-Term Facilitation in Corticothalamic Synapses and Determines Seizure Susceptibility. Cell Rep. 2020 Jul 21;32(3):107921
• All: 1 reference(s)