Gt(ROSA)26Sor^{em1(CAG-tdTomato)Jahe}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gt(ROSA)26Sor^{em1(CAG-tdTomato)Jahe}
• Name: gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 1, Jason Heaney
• MGI ID: MGI:6507752
• Synonyms: Ai9-SauSpyCas9
• Gene: Gt(ROSA)26Sor Location: Chr6:113044389-113054205 bp, - strand Genetic Position: Chr6, 52.73 cM
• Alliance: Gt(ROSA)26Sor^{em1(CAG-tdTomato)Jahe} page

Mutation origin

• Strain of Origin: B6.Cg-Gt(ROSA)26Sor^{tm9(CAG-tdTomato)Hze}/J
• Project Collection: CPMM

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready, Reporter)
• Mutation: Insertion
• Mutation details: Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sor^{tm9(CAG-tdTomato)Hze} (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTATT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression. (J:302103)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Gt(ROSA)26Sor Mutation: 993 strains or lines available

Notes

This allele was generated from Gt(ROSA)26Sor^{tm9(CAG-tdTomato)Hze}.

References

• Original: J:302103 Heaney J, Direct data submission of a CRISPR-modified Ai9 allele. MGI Direct Data Submission. 2020
• All: 2 reference(s)