Plpp7^em1Eno
Endonuclease-mediated Allele Detail

Summary

• Symbol: Plpp7^em1Eno
• Name: phospholipid phosphatase 7 (inactive); endonuclease-mediated mutation 1, Eric N Olson
• MGI ID: MGI:6507762
• Synonyms: Net39 KO
• Gene: Plpp7 Location: Chr2:31985540-32000827 bp, + strand Genetic Position: Chr2, 22.02 cM
• Alliance: Plpp7^em1Eno page

Mutation origin

• Strain of Origin: (C57BL/6 x C3H)F1

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: A 559 bp deletion including exon 1 was engineered using sgRNAs (targeting TCCCTGAACCAGCCCCCCAA and GGGTTGGGCCGGCTCCCAGA) with CRISPR/Cas9 technology. RNA sequencing and Western blot analysis confirmed lack of expression from this allele. (J:302139)

Expression

In Mice Carrying this Mutation:	27 assay results 1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation:	3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Plpp7 Mutation: 9 strains or lines available

References

• Original: J:302139 Ramirez-Martinez A, et al., The nuclear envelope protein Net39 is essential for muscle nuclear integrity and chromatin organization. Nat Commun. 2021 Jan 29;12(1):690
• All: 1 reference(s)