Mpzl1^em1Ambt
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mpzl1^em1Ambt
• Name: myelin protein zero-like 1; endonuclease-mediated mutation 1, Anton M Bennett
• MGI ID: MGI:6507873
• Synonyms: Mpzl1^Y242F, PZR^Y242F
• Gene: Mpzl1 Location: Chr1:165419809-165462107 bp, - strand Genetic Position: Chr1, 72.94 cM
• Alliance: Mpzl1^em1Ambt page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Single point mutation
• Mutation details: Tyrosine codon 242 (TAC) was changed to a phenylalanine codon (TTC) (p.Y242F) through an A-to-T mutation (T-to-A on forward strand) using an sgRNA (targeting TCTAACTGTGCGTAAATGACTGG) and ssODN template with CRISPR/Cas9 technology. Also, two silent mutations were engineered upstream to create an AgeI diagnostic restriction site. The mutation renders the encoded peptide tyrosyl phosphorylation-defective, not only at the targeted Tyr242 but also at Tyr264. (J:301775)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Mpzl1 Mutation: 21 strains or lines available

References

• Original: J:301775 Yi JS, et al., Tyrosyl phosphorylation of PZR promotes hypertrophic cardiomyopathy in PTPN11-associated Noonan syndrome with multiple lentigines. JCI Insight. 2020 Aug 6;5(15)
• All: 1 reference(s)