Vps35l^em1Shis
Endonuclease-mediated Allele Detail

Summary

• Symbol: Vps35l^em1Shis
• Name: VPS35 endosomal protein sorting factor like; endonuclease-mediated mutation 1, Shinji Saitoh
• MGI ID: MGI:6507962
• Synonyms: Vps35l^-
• Gene: Vps35l Location: Chr7:118339401-118440712 bp, + strand Genetic Position: Chr7, 63.61 cM, cytoband F3
• Alliance: Vps35l^em1Shis page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Exon 10 was targeted with an sgRNA (targeting CCATCCGGGAACTCATTCCAAGA) using CRISPR/Cas9 technology, resulting in a 2 bp deletion of CG. Exon 10 contains mutations in human patients presenting with a phenotype similar to, but distinct from, cranio-cerebello-cardiac/Ritscher-Schinzel syndrome (3C/RSS). (J:301722)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Vps35l Mutation: 59 strains or lines available

References

• Original: J:301722 Kato K, et al., Biallelic VPS35L pathogenic variants cause 3C/Ritscher-Schinzel-like syndrome through dysfunction of retriever complex. J Med Genet. 2020 Apr;57(4):245-253
• All: 1 reference(s)