Nlrc4^em1Vnce
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nlrc4^em1Vnce
• Name: NLR family, CARD domain containing 4; endonuclease-mediated mutation 1, Russell Vance
• MGI ID: MGI:6508701
• Synonyms: Nlrc4^-
• Gene: Nlrc4 Location: Chr17:74733254-74766140 bp, - strand Genetic Position: Chr17, 45.64 cM
• Alliance: Nlrc4^em1Vnce page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Insertion
• Mutation details: A 1 bp insertion (or duplication of a T) was created using an sgRNA (targeting CTCTGGAGGCAGGAATCAAT) with CRISPR/Cas9 technology. The resulting frameshift leads to a premature stop codon. Western blot experiments confirmed the lack of peptide expression from this allele. (J:294930)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Nlrc4 Mutation: 69 strains or lines available

References

• Original: J:294930 Tenthorey JL, et al., NLRC4 inflammasome activation is NLRP3- and phosphorylation-independent during infection and does not protect from melanoma. J Exp Med. 2020 Jul 6;217(7)
• All: 3 reference(s)