Nlrc4^em2Vnce
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nlrc4^em2Vnce
• Name: NLR family, CARD domain containing 4; endonuclease-mediated mutation 2, Russell Vance
• MGI ID: MGI:6508702
• Synonyms: Nlrc4^{em2(S533A)Vnce}, Nlrc4^S533A
• Gene: Nlrc4 Location: Chr17:74733254-74766140 bp, - strand Genetic Position: Chr17, 45.64 cM
• Alliance: Nlrc4^em2Vnce page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Single point mutation
• Mutation details: Serine codon 533 (TCA) was targeted with an sgRNA (targeting CTCTGGAGGCAGGAATCAAT) and ssODN templates using CRISPR/Cas9 technology, changing it to alanine codon GCA (p.S533A). This mutation renders the encoded peptide nonphosphorylatable at this residue. Western blot experiments confirmed the expression of peptides from this allele. (J:294930)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Nlrc4 Mutation: 69 strains or lines available

References

• Original: J:294930 Tenthorey JL, et al., NLRC4 inflammasome activation is NLRP3- and phosphorylation-independent during infection and does not protect from melanoma. J Exp Med. 2020 Jul 6;217(7)
• All: 2 reference(s)