Nlrc4^em3Vnce
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nlrc4^em3Vnce
• Name: NLR family, CARD domain containing 4; endonuclease-mediated mutation 3, Russell Vance
• MGI ID: MGI:6508703
• Synonyms: Nlrc4^{em3(S533D)Vnce}, Nlrc4^S533D
• Gene: Nlrc4 Location: Chr17:74733254-74766140 bp, - strand Genetic Position: Chr17, 45.64 cM
• Alliance: Nlrc4^em3Vnce page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: Serine codon 533 (TCA) was targeted with an sgRNA (targeting CTCTGGAGGCAGGAATCAAT) and ssODN templates using CRISPR/Cas9 technology, changing it to aspartic acid codon GAT (p.S533D). This mutation creates a phosphomimetic residue at this position. Western blot experiments confirmed the expression of peptides from this allele. (J:294930)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Nlrc4 Mutation: 69 strains or lines available

References

• Original: J:294930 Tenthorey JL, et al., NLRC4 inflammasome activation is NLRP3- and phosphorylation-independent during infection and does not protect from melanoma. J Exp Med. 2020 Jul 6;217(7)
• All: 2 reference(s)