Ppil1^em2Jgg
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ppil1^em2Jgg
• Name: peptidylprolyl isomerase (cyclophilin)-like 1; endonuclease-mediated mutation 2, Joseph Gleeson
• MGI ID: MGI:6509458
• Synonyms: Ppil1^fs
• Gene: Ppil1 Location: Chr17:29469809-29482945 bp, - strand Genetic Position: Chr17, 15.15 cM
• Alliance: Ppil1^em2Jgg page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Using a gRNA (targeting GTCTGGTCCTGCGTTGGCCA) with CRISPR/Cas9 technology, a single C (G on forward strand) was deleted (NM_026845.4:c.303delC), resulting in a frameshift and premature stop codon. (J:300487)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ppil1 Mutation: 40 strains or lines available

References

• Original: J:300487 Chai G, et al., Mutations in Spliceosomal Genes PPIL1 and PRP17 Cause Neurodegenerative Pontocerebellar Hypoplasia with Microcephaly. Neuron. 2021 Jan 20;109(2):241-256.e9
• All: 1 reference(s)