Ppil1^em4Jgg
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ppil1^em4Jgg
• Name: peptidylprolyl isomerase (cyclophilin)-like 1; endonuclease-mediated mutation 4, Joseph Gleeson
• MGI ID: MGI:6509462
• Synonyms: Ppil1^R131Q
• Gene: Ppil1 Location: Chr17:29469809-29482945 bp, - strand Genetic Position: Chr17, 15.15 cM
• Alliance: Ppil1^em4Jgg page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Using a crRNA (targeting TCCCTATACCCTGGCACACT), a tracrRNA and an ssODN template (GGTCCTGGGAGTTTGTTTCCACCATGCCCACTCGATTCACCATCCCTATACCCTGGCACACTTGTCCAAAAATAGTATGCTTGCCGTCCAGCCATTGCGTGGGGGCCAGGGTCACAAAGAAC) with CRISPR/Cas9 technology, a single G-to-A mutation (C-to-T on forward strand) was engineered to change arginine codon 131 (CGA) to a glutamine codon (CAA) (p.R131Q). This mutation mimics a human mutation found in pontocerebellar hypoplasia plus microcephaly (PCHM) patients. (J:300487)

Disease models

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ppil1 Mutation: 40 strains or lines available

References

• Original: J:300487 Chai G, et al., Mutations in Spliceosomal Genes PPIL1 and PRP17 Cause Neurodegenerative Pontocerebellar Hypoplasia with Microcephaly. Neuron. 2021 Jan 20;109(2):241-256.e9
• All: 1 reference(s)